Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

Originally published as JCO Early Release 10.1200/JCO.2005.03.4074 on June 26 2006

Journal of Clinical Oncology, Vol 24, No 23 (August 10), 2006: pp. 3771-3779
© 2006 American Society of Clinical Oncology.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reu, F. J.
Right arrow Articles by Borden, E. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reu, F. J.
Right arrow Articles by Borden, E. C.

Overcoming Resistance to Interferon-Induced Apoptosis of Renal Carcinoma and Melanoma Cells by DNA Demethylation

Frederic J. Reu, Soo In Bae, Leonid Cherkassky, Douglas W. Leaman, Daniel Lindner, Normand Beaulieu, A. Robert MacLeod, Ernest C. Borden

From the Taussig Cancer Center, Cleveland Clinic Foundation, Cleveland; University of Toledo, Toledo, OH; MethylGene Inc, Québec, Canada.

Address reprint requests to Ernest C. Borden, MD, The Cleveland Clinic Foundation Taussig Cancer Center, R40, 9500 Euclid Ave, Cleveland, OH 44195; e-mail: bordene{at}ccf.org


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 XAF1 5' Regulatory Region...
 Overexpression of XAF1 Overcomes...
 Reactivation of Genes by...
 Mouse Tumor Xenografts
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
Epigenetic editing of gene expression by aberrant methylation of DNA may help tumor cells escape attack from the innate and acquired immune systems. Resistance to antiproliferative effects and apoptosis induction by interferons (IFNs) was postulated to result from silencing of IFN response genes by promoter hypermethylation. Treatment of human ACHN renal cell carcinoma (RCC) and A375 melanoma cells with the DNA demethylating nucleoside analog 5-AZA-2'-deoxycytidine (5-AZA-dC) synergistically augmented antiproliferative effects of IFN- alpha ({alpha}) 2 and IFN-beta (ß). Either 5-AZA-dC or an antisense to DNA methyltransferase 1 (DNMT1) overcame resistance to apoptosis induction by IFNs with up to 85% apoptotic cells resulting from the combinations. No similar potentiation occurred in normal kidney epithelial cells. IFN response genes were augmented more than 10 times in expression by 5-AZA-dC. Demethylation by 5-AZA-dC of the promoter of the prototypic, apoptosis-associated IFN response gene XAF1 was confirmed by methylation-specific polymerase chain reaction. siRNA to XAF1 inhibited IFN-induced apoptosis; conversely, overexpression of XAF1 overcame resistance to apoptosis induction by IFN-ß. As occurred with apoptosis-resistant melanoma cells in vitro, tumor growth inhibition in the nude mouse of human A375 melanoma xenografts resulted from treatment with 5-AZA-dC in combination with IFN-ß, an effect not resulting from either single agent. The importance of epigenetic remodeling of expression of immune-modifying genes in tumor cells was further suggested by identifying reactivation of the cancer-testis antigens MAGE and RAGE in ACHN cells after DNMT1 depletion. Thus, inhibitors of DNMT1 may have clinical relevance for immune modulation by augmentation of cytokine effects and/or expression of tumor-associated antigens.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 XAF1 5' Regulatory Region...
 Overexpression of XAF1 Overcomes...
 Reactivation of Genes by...
 Mouse Tumor Xenografts
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
Like mutational deletions, epigenetic regulation of gene expression through methylation and acetylation are integral and common parts of the neoplastic process.1-4 Hypermethylation of DNA in promoter regions can result in heritable silencing of genes that control cell differentiation, proliferation, apoptosis, and function. Silencing of genes is maintained by DNA methyltransferases (DNMTs), which, during DNA replication copy methylation patterns to the daughter strand.1-4 Epigenetic editing of gene expression by aberrant methylation of DNA in both tumor cells and lymphocytes may influence signaling and expression of proteins important for functioning of the innate and acquired immune systems.1-6

As products of the activated immune system, interferons (IFNs) influence differentiation, function, and survival of not only immune effector cells but also cells of stroma, endothelium, and organ parenchyma.7-9 Suppression of endogenous IFNs in mice enhances tumor development.10-11 Gene expression profiling, protein expression, and cytogenetic analyses have identified decreases in the transcriptionally regulated, IFN-stimulated genes (ISGs) in immune effector and in melanoma and colon, breast, and hematologic malignancies.12-22 Epigenetic silencing by DNA methylation of genes such as STAT1, TRAIL R1, IRF-7, and DAPK that are essential for various actions of IFNs, has been identified, suggesting that hypermethylation may confer growth advantage through resistance to endogenous IFNs.23-26 Thus, silencing of ISG expression may influence tumor development or progression.

Functional consequences of epigenetic silencing by hypermethylation of cytokine and IFN signaling pathways have been evaluated little. To confirm our hypothesis that inhibition of actions of IFNs could result from epigenetic silencing of ISGs, resistance to gene expression and apoptosis were assessed in melanoma and renal cell carcinoma (RCC) after an inhibitor of DNMTs, 5-AZA-2'-deoxycytidine (5-AZA-dC), and a selective antisense oligonucleotide for DNMT1. To further suggest clinical relevance, expression of tumor-associated antigens in vitro and murine tumor growth in vivo was assessed after the methylation inhibitors.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 XAF1 5' Regulatory Region...
 Overexpression of XAF1 Overcomes...
 Reactivation of Genes by...
 Mouse Tumor Xenografts
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
Cell Lines and IFNs
ACHN, A375, A375.S2, SK-Mel-1, SK-Mel-3, SK-Mel-28, MeWo, HeLa (American Type Culture Collection, Manassas, VA), SK-RC-45, SK-RC-29 (Memorial Sloan-Kettering Cancer Center, New York, NY), MUM-2B, MUM-2C, OCM-1, C-918 (ocular melanomas provided by Mary J. Hendrix, Northwestern University, Evanston, IL), and normal kidney epithelial cells NKE39 and NKE58 (from nephrectomy specimens, Cleveland Clinic Foundation, Cleveland, OH) were cultured in 5% CO2 using Minimum Essential Medium (MEM; GIBCO, Invitrogen, Carlsbad, CA) or Dulbecco's MEM with 0.1 mmol/L nonessential amino acids (GIBCO), 1.0 mmol/L pyruvate (GIBCO), 10% fetal bovine serum, penicillin G (50 U/mL), and streptomycin (50 µg/mL). Recombinant IFN-alpha ({alpha}) 2b (Schering-Plough, Kenilworth, NJ) and IFN-beta (ß) 1a (Serono, Rockland, MA) had specific activities of 2 x 108 U/mg protein.

5-AZA-dC, DNMT1 Antisense, and XAF-1siRNA Transfections
5-AZA-dC (Sigma-Aldrich, St Louis, MO) stock solution (100 mmol/L) in dimethyl sulfoxide and working solutions for one-time use were stored at –20°C. Four hours after the last 5-AZA-dC, cells were replated into media not containing 5-AZA-dC for IFN treatment. To selectively downregulate DNMT1, cells were transfected with MG98 or the mismatch control (MethylGene, Québec, Canada), a second-generation 4 x 4 2'O methyl phosphorothioate oligonucleotide antisense against the 3' untranslated region of DNMT1.27 Antisense was begun one day after plating at concentrations that allowed at least doubling of cell number in 48 hours and optimal transfection efficiency (5,000 and 15,000 cells/cm2 for SK-RC-45 and ACHN cells, respectively). XAF1 siRNA transfections were performed like DNMT1 AS transfections, but with 12,500 cells/cm2 plated the day before transfection, and with 15 to 20 minutes preincubation of siRNA in Lipofectin transfection reagent (Invitrogen) according to the manufacturer’s instructions to allow for formation of complexes. For A375 and A375.S2 cells, Lipopfectamine 2000 (Invitrogen) was used as transfection reagent (6 µg/mL) for siRNA transfections, and cells were transfected at 90% confluency. XAF1 and control siRNAs were obtained from Invitrogen (Stealth).

Western Blotting
Protein (20 to 40 µg) from whole-cell lysates were probed for DNMT1 by polyclonal antibody (pAB; MethylGene); Stat1, Stat2, Stat3 by monoclonal antibody (mAB; BD Transduction Laboratories, San Jose, CA), Caspase 3 and PARP by pAB (BIOMOL, Plymouth Meeting, PA), RASSF1A by mAB (eBioscience, San Diego, CA), XAF1 by mAB (D.W. Leaman), and actin by mAB (Sigma-Aldrich) after separation in 8% to 14% sodium dodecyl sulfate (SDS) -polyacrylamide gels, transfer to polyvinylidene fluoride membranes, then detected by horseradish tagged goat antimouse or goat antirabbit antibody (Bio-Rad, Hercules, CA), and staining with chemiluminescence solution (Amersham, Piscataway, NJ).

Growth Inhibition (sulforhodamine B) and Apoptosis Assays
After 4 days of IFNs, cells were harvested for a previously described sulforhodamine B (SRB) assay.28 For apoptosis assays, cells were plated for terminal deoxynucleotidyltransferase (TdT) dUTP nick end labeling (TUNEL) assay with IFNs added 16 to 24 hours after plating and by caspase 3 (BD Clontech, Palo Alto, CA), both as previously described.28

RNA Isolation and cDNA Synthesis
RNA was isolated using the Trizol (Invitrogen) method and cDNA prepared with a superscript III first strand synthesis kit including a final RNase H digestion step (Invitrogen) according to the manufacturer's instructions. Using custom Taqman expression primers (Applied Biosystems, Foster City, CA) real-time reverse transcriptase polymerase chain reaction (RT-PCR) was performed according to the manufacturer instructions using ABI PRISM Sequence Detection Instrument 7700 (Applied Biosystems).

Bisulfite Modification and Methylation-Specific PCR
Genomic DNA (1 µg), harvested with a blood DNA mini kit (Quiagen, Valencia, CA) was used for bisulfite modification with the CpGenome kit (Chemicon International, Temecula, CA) with final resuspension in 10 mmol/L Tris/Cl, pH 8.5. Four µl of bisulfite modified DNA was used per 25 µL methylation-specific PCR (MSP) reaction using designed primers (Fig 1). Primers for XAF1 MSP were designed for a region found frequently hypermethylated on bisulfite sequencing in gastric cancer39 and were for methylated XAF1 5'-regulatory region (forward) GTTTGTAAGAAACGAAATTTAATCGA, and (reverse) GCCAACCCGAATCTACCG and for unmethylated XAF1 DNA (forward) TGTTTGTAAGAAATGAAATTTAATTGAAAG and (reverse) TCACCAACCCAAATCTACCAC. PCR settings for methylation-specific and non–methylation-specific primer pairs were denaturation at 95°C for 5 minutes, followed by 35 cycles with a 1-minute denaturation step, 30 seconds annealing at 60°C, and extension at 72°C for 30 seconds. Final extension after 35 cycles was at 72°C for 4 minutes. Products were visualized by UV light after separation on 8% acrylamide gels and staining with ethidium bromide.


Figure 1
View larger version (21K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig 1. Depletion of DNA methyltransferase 1 (DNMT1) by 5-AZA-2'-deoxycytidine (5-AZA-dC; AZA) or DNMT1 antisense (AS) and demethylation of 5 regulatory region of XAF1 in ACHN and A375 cells. Immunoblotting identified reduction of free DNMT1 protein in ACHN and A375 cells treated with 5-AZA-dC (AZA) or DNMT1 antisense (AS) compared with untreated controls (Ctrl) or cells treated with DNMT1 mismatch (MM) or lipofectin (Lipo) transfectin reagent alone (A). Methylation-specific polymerase chain reaction–confirmed demethylation of hypermethylated 5'-XAF1 regulatory region in ACHN and A375 cells. SKMel3 and SKRC45 cells were used as unmethylated controls (B). M, methylated DNA; U, unmethylated DNA.

 
Tumor Xenografts
Ncr nude mice (Taconic Farms, Hudson, NY) of approximately 6 weeks of age were inoculated subcutaneously in the flank with 106 A375 melanoma cells. Mice were killed humanely after 26 days of tumor growth.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 XAF1 5' Regulatory Region...
 Overexpression of XAF1 Overcomes...
 Reactivation of Genes by...
 Mouse Tumor Xenografts
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
DNMT1 Depletion by Antisense or 5-AZA-dC Reverses Resistance to IFN-Induced Apoptosis in RCC and Melanoma Cells
RCC and melanoma cell lines were treated with 5-AZA-dC followed 1 day later by IFN-{alpha}2 or IFN-ß. Synergistic growth inhibition resulted (Fig 2). Microscopic observation identified condensed nuclei and increase in floating cells suggestive of apoptosis with combined treatment (data not shown). Therefore, frequency of cells containing apoptotic fragmented DNA was quantified by TUNEL assay in RCC and melanoma cell lines after sequential 5-AZA-dC and IFN-{alpha}2 or IFN-ß.


Figure 2
View larger version (22K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig 2. Synergistic antiproliferative effect of 5-AZA-2'-deoxycytidine (5-AZA-dC) and interferons (IFNs). ACHN (A, B) and A375 (C, D) cells were treated with 5-AZA-dC followed by IFN-{alpha} or IFN-ß at indicated doses. Growth was measured over 5 days by SRB (protein)-staining and synergy determined according to median effect analysis. ci, combination index; fa, fraction affected.

 
Although all cell lines in Figures 2 and 3 were completely resistant to apoptosis induction by IFNs alone (< 10% TUNEL+ cells after 4 to 5 days of IFN- {alpha}2 or IFN-ß at 50 to 500 U/mL), pretreatment with 5-AZA-dC (100 to 200 nmol/L over 4 days) resulted in at least two-fold increase of apoptotic cells by IFN-{alpha}2 (Fig 3A). IFN-ß at equal dose (50 to 500 U/mL over 4 to 5 days) was more potent, resulting in 25% to 83% apoptotic cells after pretreatment with 5-AZA-dC (100 to 200 nmol/L over 4 days) (Fig 3A). Normal kidney epithelial (NKE) cells treated with 100 nmol/L 5-AZA-dC over 4 days before 100 U/mL IFN-{alpha}2 or IFN-ß over 5 days responded differently, whereas 5-AZA-dC caused moderate apoptosis (13%) addition of IFN-{alpha}2 or IFN-ß minimally altered frequency of apoptotic cells (6.5% to 20.5% apoptotic cells) and caused no apoptosis (< 10% TUNEL+) when administered alone (Fig 3A).


Figure 3
View larger version (32K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig 3. Resistance to interferon (IFN)-induced apoptosis of renal cell carcinoma (RCC) and melanoma but not normal kidney epithelial (NKE) cells was overcome by treatment with DNA methyltransferase 1 (DNMT1) inhibitors. Cell lines or early passage (first to second) NKE cells from nephrectomy specimens were treated with 100 to 200 nM 5-AZA-2'-deoxycytidine (5-AZA-dC; AZA) over 4 days or 40 nM DNMT1 antisense (AS) over 6 to 8 days followed by treatment with IFNs (50 to 500 U/mL). Apoptosis was quantified by flow cytometric terminal deoxynucleotidyltransferase dUTP nick end labeling (TUNEL) analysis (A) and confirmed by immunoblotting for cleaved caspase 3 and PARP (B). Ctrl, control; MM, DNMT1 mismatch; Lipo, lipofectin.

 
Treatment ACHN and SK-RC-45 cells with the selective DNMT1 antisense (AS) inhibitor MG98 similarly overcame resistance to IFN-induced apoptosis (Fig 3A). Western blotting for cleaved (activated) caspase 3 and PARP cleavage (Fig 3B) and caspase 3 activity assays (data not shown) confirmed apoptosis induction.

Cell-Specific Reactivation by DNMT1 Inhibitors of Genes Participating in IFN-Induced Apoptosis
Immunoblots confirmed DNMT1 depletion by AS and 5-AZA-dC in ACHN (Fig 1A) and SK-RC-45 cells (data not shown). In A375 cells, both 5-AZA-dC and the DNMT1 AS also markedly reduced available DNMT1 protein (Fig 1A). To investigate whether genes known to participate in IFN-induced apoptosis2 that may have been silenced by DNA methylation were reactivated by 5-AZA-dC, quantitative RT-PCR was undertaken after treatment with 100 to 200 nmol/L over 4 days.

XAF1 was increased more than 10-fold by methylation inhibition in six of 12 cancer cell lines (between 27- and 150-fold), including one of three RCC (ACHN), two of five melanoma (A375, MeWo), and three of four ocular melanoma cell lines (MUM-2B, MUM-2C, OCM-1). RASSF1A was increased more than 100-fold in eight of 12 tumor cell lines, including all RCC cells, two of five melanoma (A375, SK-Mel-28), and three of five ocular melanoma cells (MUM-2C, OCM-1, C-918), TRAIL R1 was increased 30- to 70-fold in two melanoma cell lines (SK-Mel-1, SK-Mel-3), TRAIL R2 90- to 130-fold in two ocular melanoma cells (MUM-2C, OCM-1), TRAIL 20- to 80-fold in two ocular melanoma and one melanoma cell line (MUM-2C, OCM-1, MeWo), and STAT2 13-fold in MeWo melanoma cells. In NKE cells, no increase of 10-fold occurred after 5- AZA-dC (100 nmol/L over 4 days; Table 1). In summary, reactivation of genes was cell specific, suggesting that individual cell clones derived survival benefit from silencing specific genes while tolerating expression of other genes that may be more critical to the survival of different cell clones.


View this table:
[in this window]
[in a new window]

 
Table 1. Real-Time RT-PCR > 10-Fold Increase in Expression by DNMT Inhibition (black)

 

    XAF1 5' Regulatory Region Demethylation Augments XAF Protein Induction by IFN and XAF-siRNA Inhibits IFN-Induced Apoptosis
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 XAF1 5' Regulatory Region...
 Overexpression of XAF1 Overcomes...
 Reactivation of Genes by...
 Mouse Tumor Xenografts
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
Immunoblots had confirmed similar DNMT1 depletion by AS and 5-AZA-dC in ACHN (Fig 1A) and SK-RC-45 cells (data not shown). In A375 cells, both 5-AZA-dC and the DNMT1 antisense also markedly reduced DNMT1 protein (Fig 1A). MSP determined that reactivation of XAF1 in ACHN and A375 cells by DNMT1 inhibitors was associated with demethylation of hypermethylated 5' regulatory region (Fig 1B). Cells not markedly altered by 5-AZA-dC had higher baseline XAF1 mRNA expression (data not shown); these had an unmethylated XAF1 5' regulatory region (SK-Mel-3 and SK-RC-45; Table 1; Fig 1B).

To determine whether 5-AZA-dC increased XAF protein induction by IFN and whether silencing of XAF1 conferred resistance to IFN-induced apoptosis, ACHN cells were treated concurrently with 5-AZA-dC and XAF1 siRNA before IFN. 5-AZA-dC increased XAF1 protein induction by IFN (Fig 4A) and siRNA against XAF1 decreased apoptosis induction by IFN-ß (50 U/mL over 4 days) from 59% to 18% in cells pretreated with 2 days of 5-AZA-dC (200 nmol/L; Fig 4B). In A375 cells, 5-AZA-dC alone resulted in XAF1 protein expression, but induction of XAF1 by IFNs appeared to be intact despite DNA methylation, suggesting a more complex mechanism of transcriptional regulation in these cells. Nevertheless, XAF siRNA reduced IFN-induced apoptosis of 5-AZA-dC treated cells from 13.2% to 6.8%. To further confirm the role of XAF1 in IFN-induced apoptosis, A375.S2 cells, known to undergo apoptosis after IFNs, were transfected with siRNA against XAF1. This reduced apoptosis after 100 U/mL IFN-ß from 52% to 14% with associated decrease in XAF1 protein (Fig 4C). Thus, decreases in XAF1 resulted in diminished apoptosis.


Figure 4
View larger version (17K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig 4. Sensitivity to interferon (IFN) -induced apoptosis in DNA methyltransferase 1 (DNMT1)–depleted cells was reduced by XAF1 siRNA. Cotreatment of ACHN cells with XAF1 siRNA and 5-AZA-2'-deoxycytidine (5-AZA-dC); reduced XAF1 protein and apoptosis in response to IFN-ß (A, B). An IFN-sensitive A375.S2 cells siRNA against XAF1 similarly reduced apoptosis and XAF1 protein expression in response to IFN-ß (C). Ctrl, control.

 

    Overexpression of XAF1 Overcomes Resistance to IFN-Induced Apoptosis
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 XAF1 5' Regulatory Region...
 Overexpression of XAF1 Overcomes...
 Reactivation of Genes by...
 Mouse Tumor Xenografts
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
XAF1 was overexpressed in ACHN cells to determine whether increased XAF1 protein expression alone, independent of other genes reactivated by 5-AZA-dC, could overcome resistance to apoptosis induction by IFNs. IFN-ß (50 U/mL over 24 hours) weakly induced XAF1 protein in empty vector controls, whereas stable transfection of XAF1 resulted in XAF1 protein expression that was detectable without addition of IFN. Treatment with IFN augmented expression to levels comparable to those achieved by treatment of cells with 5-AZA-dC and IFN (Figs 4 and 5). ACHN cells overexpressing XAF1 treated with IFN-ß at 50 U/mL over 5 days underwent little apoptosis (6.5% TUNEL+) suggesting that reactivation of additional genes may be necessary for apoptosis induction by low doses of IFN in DNMT1-depleted cells. However, when treated with 500 U/mL IFN-ß over 5 days, more than 80% of XAF1 overexpressing cells were apoptotic, whereas empty vector-carrying cells were resistant to even high doses of IFN-ß (<3.2% TUNEL+ after 5 days at 500 U/mL; Fig 5B). This further confirmed a role for XAF1 in apoptosis induction by IFNs.


Figure 5
View larger version (20K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig 5. (A-B) Resistance to apoptosis induction by interferons (IFNs) overcome by overexpression of XAF1. Overexpression of XAF1 in ACHN cells through a plasmid vector overcame resistance to high-doses of IFN-beta (ß; 500 U/mL), whereas lower doses (50 U/mL) had not much effect (A, B). XAF1 cDNA from IFN treated A375 cells was cloned into pcDNA3.1 and stably expressed in ACHN cells using G418 as selective antibiotic. Sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis (PAGE) and Western blot analysis using XAF1 monoclonal antibody (D.W. Leaman, Toledo, OH) was used to confirm expression.

 

    Reactivation of Genes by DNMT1 Depletion That May Enhance Immune Response
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 XAF1 5' Regulatory Region...
 Overexpression of XAF1 Overcomes...
 Reactivation of Genes by...
 Mouse Tumor Xenografts
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
To determine whether other genes that might enhance anticancer effect of IFNs were reactivated through DNA demethylation, cRNA array (Affymetrix [Santa Clara, CA] U133A microarray) analysis with RNA harvested from ACHN cells 24 hours after the eighth DNMT1 AS transfection was undertaken. In this assay, compared with mismatch control oligonucleotide (MM), DNMT1 AS resulted in a 94% reduction in DNMT1 expression, while not affecting expression of other DNMTs (data not shown). Among the 43 genes increased at least four-fold (P < .045) by DNMT1 AS, seven were cancer-testis antigens (CTAs), and 12 had functions related to cytokine signaling (Table 2). DNA sequences were assessed for CpG islands within 200 base pairs (bp) 5' of the transcription start using a CpG island searcher (http://www.usccancer.com/cpgislands/cpg.aspx) and a definition of length of at least 200 bp, GC% at least 50, and observed/expected CpGs at least 0.6. Most tumor antigens had CpG islands close to the transcription start, suggesting direct regulation of transcription by DNA methylation, whereas those genes involved in cytokine signaling, lacking CpG islands in close proximity to the transcription start, may have been increased through indirect mechanisms. Thus, whether through DNA demethylation or indirect mechanisms, DNMT1 depletion led to changes in gene expression that might enhance antitumor immune responses by effects on cytokine signaling and cell-surface antigen expression.


View this table:
[in this window]
[in a new window]

 
Table 2. Genes With Possible Effect on Immune Responses Increased at Least Four-Fold in DNMT1-Depleted ACHN Cells (U133A cRNA array)

 

    Mouse Tumor Xenografts
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 XAF1 5' Regulatory Region...
 Overexpression of XAF1 Overcomes...
 Reactivation of Genes by...
 Mouse Tumor Xenografts
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
To define further the potential clinical relevance of DNMT1 suppression by 5-AZA-dC, A375 melanoma cells were inoculated into nude mice and treated with either a single dose of 5-AZA-dC, daily doses of IFN-ß, or the combination (Fig 6). Significant suppression of tumor growth resulted only from the combination and was evident throughout the growth curve. As control tumors grew larger, the combination treatment resulted in significant suppression (P < .05) in comparison to control and also in comparison to either single agent.


Figure 6
View larger version (11K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig 6. Effect of 5-AZA-deoxycytidine (5-AZA-dC) on growth of human A375 melanoma xenografts in nude mice. A375 melanoma cells (106) were inoculated into each flank subcutaneously and 2 days later 5-AZA-dC was administered at a total dose of 15 mg/kg to appropriate groups in three divided doses 3 hours apart intraperitoneally. IFN-beta (ß), 105 units/mouse, was initiated 4 days later on a 5 days/week schedule subcutaneously. Control, green diamonds; IFN-ß, red circles; 5-Aza-dC, green squares; combination treatment gray triangles. Of the treatments, only the combination was significantly reduced from control (P < .05). A repeat experiment yielded similar results.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 XAF1 5' Regulatory Region...
 Overexpression of XAF1 Overcomes...
 Reactivation of Genes by...
 Mouse Tumor Xenografts
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
In normal cells, the dinucleotide CpG, particularly in promoter regions of genes, is only sparsely methylated. In contrast, in tumor cells, heavy methylation of CpG islands in promoters occurs, resulting in inhibition of binding of many critical transcription factors.1-4 This increased methylation probably results from increased activity of DNMTs, which can be many-fold higher in activity in neoplastic cells when compared with nontumor cells.1-4 Suppression of DNMT activity can be achieved by the nucleoside analogs of cytidine, which after incorporation into DNA, covalently bind DNMTs and result in re-expression of methylation silenced transcription.3,4,27,29,30 Although azacytidine analogs have broad specificity for DNMTs, removing them from their sites of enzymatic action, incorporation into DNA could also activate DNA damage pathways. Thus, although potentially with some loss of potency because of the various isoforms of DNMT, greater specificity could result from antisense oligonucleotides targeted at specific DNMTs.

At doses that alone caused minimal apoptosis, 5-AZA-dC overcame complete resistance to apoptosis induction by IFNs (Fig 3). Inhibition of the DNMT1 isoform alone by a targeted oligonucleotide antisense or siRNA has been sufficient for re-expression of silenced genes.27,30 Consistent with this, suppression of DNMT1 by an antisense oligonucleotide had similar effects on overcoming resistance to programmed cell death induction by IFNs as did 5-AZA-dC (Fig 1Go). Furthermore, both were potent in enhancing expression of genes of potential importance in signaling and apoptosis induction by IFNs and other cytokines (Table 1). Neither of the normal renal epithelial cells assessed had augmentation of expression of any of the genes. Conversely, RASSF1A, a gene commonly silenced by methylation31-32 was increased in seven of 11 of the RCC and melanoma cell lines (Table 1).

To further examine the clinical potential of the combination treatment, the human A375 melanoma cell line was grown in the nude mouse. A375 cells were resistant to apoptosis induction in vitro and treatment with IFN-ß in vivo (Figs 3 and 6). A single dose of 5-AZA-dC administered 4 days before beginning treatment of the established tumors with IFN-ß resulted in significant (P < .05) suppression of growth of the melanoma otherwise resistant to IFN-ß, whereas neither treatment alone result in significant decreases in tumor size from the control. Since this dose and schedule of 5-AZA-dC was chosen semi-empirically, greater suppression may result from higher or more frequent doses or by use of the antisense to DNMT1.

Counteracting cellular apoptotic processes are proteins involved in preventing unregulated cell suicide. Among these are the inhibitors of apoptosis (IAPs) such as XIAP.33 XIAP binds to caspases, thus functioning as competitive inhibitors of the autocatalytic function of caspases.33-36 Yeast two-hybrid studies have identified an XIAP-interacting protein designated XAF1.37,38 Incubation of recombinant XIAP in the presence of XAF1 blocked apoptosis inhibition by XIAP.39 Because expression was lower in tumor cell lines as compared with normal tissues including melanoma, XAF1 has been implicated as a tumor suppressor.37,39,40

Hypermethylation of a CpG island in the 5' regulatory region of XAF1 was found in ACHN and A375 cells, and DNMT1 depletion led to demethylation (Fig 1). This was associated with reactivation of mRNA expression and additional augmentation of XAF1 protein induction by IFNs (Table 1; Fig 4A). Inhibition of XAF1 by siRNA in DNMT1 depleted ACHN cells markedly reduced apoptosis to low doses of IFN-ß (Fig 4B). Conversely, on overexpression of XAF1, 10-fold higher doses of IFN-ß were required to elicit marked apoptosis (Fig 5B). IFNs induced high levels of XAF1 protein predominantly in cell lines sensitive to the proapoptotic effects of IFN-{alpha}2 and IFN-ß.41 These observations suggested that XAF1 played a critical role in apoptosis induction by IFNs after DNMT1 depletion but that reactivation of additional genes might contribute. RASSF1A is one such candidate because siRNA also inhibited IFN induced apoptosis in ACHN cells after DNMT1 depletion.42

Suppression of ISGs in humans is emerging as an important contributor to development of clinical neoplasia. Expression profiling of melanoma cell and other cell lines, when compared with melanocytes, has identified a large number of IFN-stimulated genes (ISGs) that are suppressed in expression.20 Mutation of a gene in the IFN response pathway, RNase L, increases prostate cancer risk.43,44 Critical protein components of immune effector cells are regulated by IFNs.7,9,45,46 Reaching the full potential of exogenous IFNs as cancer therapeutics in humans will result from additional understanding of the mechanisms of antitumor action and more potent induction of the transcriptionally regulated ISGs such as XAF1.

Hypermethylation of CpG islands in gene promoters can influence expression of a diversity of proteins that influence interaction of tumor cells with their microenvironment and the host immune response.5,6 DNMT1 depletion increased expression (10 to 100x) of cytokine signaling molecules and of CTAs (Table 2). 5-AZA-dC has increased expression of CTAs and enabled cell lysis by CTA-specific cytotoxic lymphocytes.47 Clones from a melanoma with variable CTA expression treated with 5-AZA-dC became relatively homogenous in CTA expression.48 A 7-day continuous infusion schedule of 5-AZA-dC reactivated MAGE 1 with acceptable toxicity.49 Thus, inhibitors of DNA methylation may result in "immunologic synergism" in augmenting function of the signaling pathways of not only the innate immune system, as illustrated by effects on IFN-induced apoptosis, but also acquired immunity through effects on augmentation of tumor-associated antigens.

Thus, inhibitors of DNMT1 may have clinical relevance for immune modulation by augmentation of cytokine effects and/or expression of tumor-associated antigens. We have identified a proapoptotic ISG, XAF1, that was silenced by methylation in RCC and melanoma and whose re-expression augmented apoptosis induced by IFNs. RCC and melanoma have been treated with IFN-{alpha}2, but only approximately 15% of patients respond. Results of our in vitro and mouse xenograft in vivo studies suggest that DNMT inhibitors may augment antitumor action of IFNs in RCC or melanoma patients.


    Authors' Disclosures of Potential Conflicts of Interest
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 XAF1 5' Regulatory Region...
 Overexpression of XAF1 Overcomes...
 Reactivation of Genes by...
 Mouse Tumor Xenografts
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
Although all authors completed the disclosure declaration, the following authors or their immediate family members indicated a financial interest. No conflict exists for drugs or devices used in a study if they are not being evaluated as part of the investigation. For a detailed description of the disclosure categories, or for more information about ASCO's conflict of interest policy, please refer to the Author Disclosure Declaration and the Disclosures of Potential Conflicts of Interest section in Information for Contributors.


Authors Employment Leadership Consultant Stock Honoraria Research Funds Testimony Other

Normand Beaulieu MethylGene Inc (N/R) MethylGene Inc (A)
A. Robert MacLeod MethylGene Inc (N/R) MethylGene Inc (B)
Ernest C. Borden MethylGene Inc (B)

Dollar Amount Codes (A) < $10,000 (B) $10,000-$99,900 (C) ≥ $100,000 (N/R) Not Required


    Author Contributions
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 XAF1 5' Regulatory Region...
 Overexpression of XAF1 Overcomes...
 Reactivation of Genes by...
 Mouse Tumor Xenografts
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 

Conception and design: Frederic J. Reu, Soo In Bae, Douglas W. Leaman, A. Robert MacLeod, Ernest C. Borden

Financial support: Normand Beaulieu, A. Robert MacLeod, Ernest C. Borden

Administrative support: Ernest C. Borden

Provision of study materials or patients: Normand Beaulieu, A. Robert MacLeod, Ernest C. Borden

Collection and assembly of data: Frederic J. Reu, Soo In Bae, Leonid Cherkassky, Douglas W. Leaman, Ernest C. Borden

Data analysis and interpretation: Frederic J. Reu, Soo In Bae, Leonid Cherkassky, Douglas W. Leaman, Mark W. Fox, Normand Beaulieu, A. Robert MacLeod, Ernest C. Borden

Manuscript writing: Frederic J. Reu, Ernest C. Borden

Final approval of manuscript: Frederic J. Reu, Normand Beaulieu, A. Robert MacLeod, Ernest C. Borden

 


    GLOSSARY
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 XAF1 5' Regulatory Region...
 Overexpression of XAF1 Overcomes...
 Reactivation of Genes by...
 Mouse Tumor Xenografts
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 

Cancer-testis antigens:
Proteins expressed on the surface of cancer and testicular cells capable of eliciting an immune response outside of the immunologically shielded testis.

Decitabine (5-aza-2'deoxycytidine):
The nucleoside analogue 5-aza-2'-deoxycytidine (5-aza-2'-CdR), which is a DNA methyltransferase inhibitor.

DNMT (DNA methyltransferase):
Enzyme that adds methyl groups from S-adenosyl methionine to bases in DNA strands after the replication of the DNA.

Epigenetic:
The transfer of information from one cell to its descendants without the information's being encoded in the nucleotide sequence of the DNA. The methylation of the promoter to inactivate a gene is an example of an epigenetic change. Epigenetic inheritance is typically transmitted in dividing cells. Although rare, it is occasionally seen in traits being transmitted from one generation to another. Epigenetic variants can arise spontaneously and just as spontaneously revert.

MSP (methylation-specific polymerase chain reaction):
MSP is a method to identify methylated cytosine bases in genomic DNA. Bisulfite treatment deaminates unmethylated cytosine residues into thymidine bases; methylation prevents deamination. Primers specific for methylated and unmethylated DNA sequences are then used in a polymerase chain reaction to amplify respective sequences.

RASSF1A (Ras association domain family member 1A):
One of the most commonly epigenetically silenced tumor suppressor genes in human cancer that controls cell cycle and apoptosis.

TRAIL (TNF-related apoptosis-inducing ligand):
Identified on the basis of sequence homology to members of the TNF family, TRAIL induces apoptosis by binding to TRAIL receptors.

TUNEL staining:
A procedure for detecting apoptotic cells. Because DNA fragmentation is a hallmark of apoptosis, the TdT-mediated dUTP-biotin nick end-labeling (TUNEL) uses the enzyme deoxynucleotidyl transferase (TdT) to directly label the fragmented DNA ends. The apoptotic cells can then either be quantified using flow cytometry or visualized in tissue sections by using colorimetric reagents.

XAF1 (XIAP-interacting protein 1):
A protein that can antagonize the anticaspase activity of XIAP and is regulated in expression by interferons. Cancer cells express less XAF1 than normal cells, suggesting that this proapoptotic protein may have tumor suppressor function.


    NOTES
 
published online ahead of print at www.jco.org on June 26, 2006.

Authors' disclosures of potential conflicts of interest and author contributions are found at the end of this article.

Terms in blue are defined in the glossary, found at the end of this article and online at www.jco.org.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 XAF1 5' Regulatory Region...
 Overexpression of XAF1 Overcomes...
 Reactivation of Genes by...
 Mouse Tumor Xenografts
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
1. Jones PA, Baylin SB: The fundamental role of epigenetic events in cancer. Nat Rev Genet 3:415-428, 2002[Medline]

2. Herman JG, Baylin SB: Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med 349:2042-2054, 2003[Free Full Text]

3. Esteller M: Aberrant DNA methylation as a cancer-inducing mechanism. Annu Rev Pharmacol Toxicol 45:629-656, 2005[CrossRef][Medline]

4. Jones PA: Overview of cancer epigentics. Semin Hematol 42:S3-S8, 2005 (suppl 2)[Medline]

5. Reiner, SL: Epigenetic control in the immune response. Hum Mol Genet. 14:R41-R46, 2005[Abstract/Free Full Text]

6. Sigalotti L, Coral S, Fratta E, et al: Epigenetic modulation of solid tumors as a novel approach for cancer immunotherapy. Semin Oncol 32:473-478, 2005[CrossRef][Medline]

7. Stark GR, Kerr IM, Williams BRG, et al: How cells respond to interferons. Annu Rev Biochem 67:227-264, 1998[CrossRef][Medline]

8. Pfeffer LM, Dinarello CA, Herberman RB, et al: Biological properties of recombinant alpha interferons: 40th anniversary of the discovery of interferons. Cancer Res 58:2489-2499, 1998[Abstract/Free Full Text]

9. Borden EC: Interferons, in Holland JF, Kufe D, Pollock R (eds): Cancer Medicine (ed 6). Baltimore, MD, Williams and Wilkins, 2003, pp 830-841

10. Gresser IF, Belardelli C, Maury MT, et al: Injection of mice with antibody to interferon enhances the growth of transplantable murine tumors. J Exp Med 158:2095-2107, 1983[Abstract/Free Full Text]

11. Reid LM, Minato N, Gresser I, et al: Influence of anti-mouse interferon serum on the growth and metastasis of tumor cells persistently infected with virus and of human prostatic tumors in athymic nude mice. Proc Natl Acad Sci U S A 78:1171-1175, 1981[Abstract/Free Full Text]

12. Parlato S, Santini SM, Sapenta C, et al: Expression of CCR-7, MIP-3beta, and Th-1 chemokines in type I IFN-induced monocyte-derived dendritic cells: Importance for the rapid acquisition of potent migratory and functional activities. Blood 98:3022-3029, 2001[Abstract/Free Full Text]

13. Landolfo S, Guarini A, Riera L, et al: Chronic myeloid leukemia cells resistant to interferon alpha lack STAT1 expression. Hematol J 1:7-14, 2000[Medline]

14. Ross DT, Scherf U, Eisen MB, et al: Systematic variation in gene expression patterns in human cancer cell lines. Nat Genet 24:227-235, 2000[CrossRef][Medline]

15. Tanaka N, Taniguchi T: The interferon regulatory factors and oncogenesis. Semin Cancer Biol 10:73-81, 2000[CrossRef][Medline]

16. Zimmer R, Thomas P: Expression profiling and interferon-beta regulation of liver metastases in colorectal cancer cells. Clin Exp Metastasis 19:541-550, 2002[CrossRef][Medline]

17. Shou J, Soriano R, Hayward SW, et al: Expression profiling of a human cell line model of prostatic cancer reveals a direct involvement of interferon signaling in prostate tumor progression. Proc Natl Acad Sci U S A 99:2830-2835, 2002[Abstract/Free Full Text]

18. Seth A, Kitching R, Landberg G, et al: Gene expression profiling of ductal carcinomas in situ and invasive breast tumors. Anticancer Res 23:2043-2051, 2003[Medline]

19. Cabrera CM, Jimenez P, Cabrera T, et al: Total loss of MHC class I in colorectal tumors can be explained by two molecular pathways: Beta2-microglobulin inactivation in MSI-positive tumors and LMP7/TAP2 downregulation in MSI-negative tumors. Tissue Antigens 61:211-219, 2003[CrossRef][Medline]

20. Hoek K, Rimm DL, Williams KR, et al: Expression profiling reveals novel pathways in the transformation of melanocytes to melanomas. Cancer Res 64:5270-5282, 2004[Abstract/Free Full Text]

21. Pitha-Rowe I, Petty WJ, Feng Q, et al: Microarray analyses uncover UBE1L as a candidate target gene for lung cancer chemoprevention. Cancer Res 64:8109-8115, 2004[Abstract/Free Full Text]

22. Akyerli CB, Beksac M, Holko M, et al: Expression of IFITM1 in chronic myeloid leukemia patients. Leukemia Res 29:283-286, 2005[CrossRef][Medline]

23. Karpf AR, Peterson PW, Rawlins JT, et al: Inhibition of DNA methyltransferase stimulates the expression of signal transducer and activator of transcription 1, 2, and 3 genes in colon tumor cells. Proc Natl Acad Sci U S A 96:14007-14012, 1999[Abstract/Free Full Text]

24. Katzenellenbogen RA, Baylin SB, German JG: Hypermethylation of the DAP-kinase CpG island is a common alteration in B-cell malignancies. Blood 93:4347-4353, 1999[Abstract/Free Full Text]

25. Lu R, Au WC, Yeow WS, et al: Regulation of the promoter activity of interferon regulatory factor-7 gene: Activation by interferon and silencing by hypermethylation. J Bio Chem 275:31805-31812, 2000[Abstract/Free Full Text]

26. Kulaeva OI, Draghici S, Tang L, et al: Epigenetic silencing of multiple interferon pathway genes after cullular immortalization. Oncogene 22:4118-4127, 2003[CrossRef][Medline]

27. Robert MF, Morin S, Beaulieu N, et al: DNMT1 is required to maintain CpG methylaton and aberrant gene silencing in human cancer cells. Nat Genetics 33:61-65, 2003[CrossRef][Medline]

28. Chawla-Sarkar M, Leaman DW, Borden EC: Preferential induction of apoptosis by interferon (IFN)-beta compared with IFN-alpha2: Correlation with TRAIL/Apo2L induction in melanoma cell lines. Clin Cancer Res 7:1821-1831, 2001[Abstract/Free Full Text]

29. Rhee I, Bachman KE, Park BH, et al: DNMT1 and DNMT3b cooperate to silence genes in human cancer cells. Nature 416:552-556, 2002[CrossRef][Medline]

30. Suzuki M, Sunaga N, Shames DS, et al: RNA interference-mediated knockdown of DNA methyltransferase 1 leads to promoter demethylation and gene re-expression in human lung and breast cancer cells. Cancer Res 64:3137-3143, 2004[Abstract/Free Full Text]

31. Burbee DG, Forgacs E, Zochbauer-Muller S, et al: Epigenetic inactivation of RASSF1A in lung and breast cancers and malignant phenotype suppression. J Natl Cancer Inst 93:691-699, 2001[Abstract/Free Full Text]

32. Hoon DS, Spugnardi M, Kuo C, et al: Profiling epigenetic inactivation of tumor suppressor genes in tumors and plasma from cutaneous melanoma patients. Oncogene 23:4014-4022, 2004[CrossRef][Medline]

33. Schimmer AD: Inhibitor of apptosis proteins: Translation basic knowledge into clinical practice. Cancer Res 64:7183-7190, 2004[Abstract/Free Full Text]

34. Vaux DL, Silke J: IAPs, RINGs and ubiquitylation. Nat Rev Mol Cell Biol 6:287-297, 2005[CrossRef][Medline]

35. Holcik M, Gibson H, Korneluk RG: XIAP: Apoptotic brake and promising therapeutic target. Apoptosis 6:253-261, 2001[CrossRef][Medline]

36. Huang Y, Lu M, Wu H: Antagonizing XIAP-mediated caspase-3 inhibition. Achilles' heel of cancers? Cancer Cell 5:1-2, 2004[CrossRef][Medline]

37. Fong WG, Liston P, Rajcan-Separovic E,: Expression and genetic analysis of XIAP-associated factor 1 (XAF1) in cancer cell lines. Genomics 70:113-122, 2000[CrossRef][Medline]

38. Liston P, Fong WG, Kelly NL, et al: Identification of XAF1 as an antagonist of XIAP anti-caspase activity. Nat Cell Biol 3:128-133, 2001[CrossRef][Medline]

39. Byun DS, Cho K, Ryu BK, et al: Hypermethylation of XIAP-associated factor 1, a putative tumor suppressor gene from the 17p13.2 locus, in human gastric adenocarcinomas. Cancer Res 63:7068-7075, 2003[Abstract/Free Full Text]

40. Ng KC, Campos EI, Martinka M, et al: XAF1 expression is signifcantly reduced in human melanoma. J Invest Dermatol. 123:1127-1134, 2004[CrossRef][Medline]

41. Leaman DW, Chawla-Sarkar M, Vyas K, et al: Identification of X-linked Inhibitor of apoptosis-associated factor-1 as an interferon-stimulated gene that augments TRAIL Apo2L-induced apoptosis. J Biol Chem 277:28504-28511, 2002[Abstract/Free Full Text]

42. Reu F, Leaman DW, Maitra RR, et al: Expression of RASSF1A, an epigenetically silenced tumor suppressor, overcomes resistance to apoptosis induction by interferons. Cancer Res 66:2785-2793, 2006[Abstract/Free Full Text]

43. Carpten J, Nupponen N, Isaacs S, et al: Germline mutations in the ribonuclease L gene in families showing linkage with HPC1. Nat Genet 30:181-184, 2002[CrossRef][Medline]

44. Casey G, Neville PJ, Plummer SJ, et al: RNASEL Arg462Gln variant is implicated in up to 13% of prostate cancer cases. Nat Genet 32:581-583, 2002[CrossRef][Medline]

45. Taniguchi T, Ogasawara K, Takaoka A, et al: IRF family of transcription factors as regulators of host response. Annu Rev Immunol 19:623-655, 2001[CrossRef][Medline]

46. Barber GN: Host defense, virsuses, and apoptosis. Cell Death Differ 8:113-126, 2001[CrossRef][Medline]

47. Sigalotti L, Fratta E, Coral S, et al: Intratumor heterogeneity of cancer/testis antigens expression in human cutaneous melanoma is methylation-regulated and functionally reverted by 5-aza-2'-deoxycytidine. Cancer Res 64:9167-9171, 2004[Abstract/Free Full Text]

48. Coral S, Sigalotti L, Altomonte M, et al: 5-aza-2'-deoxycytidine-induced expression of functional cancer testis antigens in human renal cell carcinoma: Immunotherapeutic implications. Clin Cancer Res 8:2690-2695, 2002[Abstract/Free Full Text]

49. Samlowski WE, Leachman SA, Wade M, et al: Evaluation of a 7-day continuous intravenous infusion of decitabine: Inhibition of promoter-specific and global genomic DNA methylation. J Clin Oncol 23:3897-3905, 2005[Abstract/Free Full Text]

Submitted July 11, 2005; accepted April 5, 2006.




This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
E. C. de Bruin, C. J.H. van de Velde, J. H. J.M. van Krieken, C. A.M. Marijnen, and J. P. Medema
Epithelial Human Leukocyte Antigen-DR Expression Predicts Reduced Recurrence Rates and Prolonged Survival in Rectal Cancer Patients
Clin. Cancer Res., February 15, 2008; 14(4): 1073 - 1079.
[Abstract] [Full Text]