Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

Originally published as JCO Early Release 10.1200/JCO.2005.02.2350 on December 27 2005

Journal of Clinical Oncology, Vol 24, No 5 (February 10), 2006: pp. 805-815
© 2006 American Society of Clinical Oncology.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Domínguez, G.
Right arrow Articles by Bonilla, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Domínguez, G.
Right arrow Articles by Bonilla, F.
Related Articles
Right arrowRelated Correspondence

{Delta}TAp73 Upregulation Correlates With Poor Prognosis in Human Tumors: Putative In Vivo Network Involving p73 Isoforms, p53, and E2F-1

Gemma Domínguez, José M. García, Cristina Peña, Javier Silva, Vanesa García, Lara Martínez, Constanza Maximiano, María E. Gómez, José A. Rivera, Carmen García-Andrade, Felix Bonilla

From the Department of Medical Oncology, Hospital Universitario Puerta de Hierro; Department of Surgery, Hospital Universitario Puerta de Hierro; Department of Pathology, Hospital Santa Cristina, Madrid; and the Department of Pathology, Hospital Virgen de la Salud, Toledo, Spain

Address reprint requests to Felix Bonilla, MD, PhD, Department of Medical Oncology, Hospital Universitario Puerta de Hierro, C/ San Martín de Porres, 4, 28035-Madrid, Spain; e-mail: felixbv{at}stnet.es


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 Glossary
 REFERENCES
 
PURPOSE: Although full-length TAp73 variants largely mimic p53 suppressor activities, the transactivation-deficient transcripts {Delta}TAp73 exert an oncogenic effect by inactivating p53 and TAp73 suppressor properties. Additionally, {Delta}TAp73 may cooperate with oncogenic RAS to induce cell transformation, confer drug resistance, and induce the phosphorylation of phosphorylated Rb. Here, we study the expression of TAp73 and {Delta}TAp73 variants and assess possible associations with E2F-1, p53 and K-ras status. We address the possible clinical relevance of alterations in these genes.

PATIENTS AND METHODS: We determine in 113 colon and 60 breast cancer patients (a) the expression levels of TAp73, {Delta}TAp73 ({Delta}Ex2p73, {Delta}Ex2/3p73, and {Delta}Np73), and E2F-1 transcripts by quantitative real-time reverse transcriptase polymerase chain reaction (PCR); (b) mutations in the first exon of K-ras by PCR–single-stranded confirmational polymorphism; and (c) p53 status by immunohistochemistry. Tumor characteristics were examined in each patient.

RESULTS: Both suppressor and oncogenic isoforms of TP73 were significantly coupregulated in tumor tissues. Associations were observed between (a) p53 wild type status and upregulation of some TP73 variants; (b) overexpression of E2F-1 and some TP73 forms; and (c) upregulation of {Delta}TAp73 variants and advanced pathologic stage, lymph node metastasis, vascular invasion, presence of polyps, and tumor localization.

CONCLUSION: Overexpression of TP73 variants in tumor tissues indicates that they may be involved in colon and breast carcinogenesis. The association between upregulation of {Delta}TAp73 isoforms and poor prognosis features, specifically advanced tumor stage, suggests that they may be of practical clinical prognostic value. Interestingly, the in vivo associations identified here may indicate a functional network involving p73 variants, p53, and E2F-1.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 Glossary
 REFERENCES
 
TP73 is a family member of the tumor suppressor gene TP53. 1 TP53 and TP73 share significant structural and functional homology. Both genes contain an NH2- terminal transactivation domain, a central DNA-binding domain, and a COOH-terminal oligomerization domain,2 and are capable of inducing cell cycle arrest and cell death in response to DNA damage.3 However, some evidence indicates that the roles of p53 and p73 in human tumorigenesis are different: (a) there are no inactivating mutations in TP733; (b) wild-type TP73 is overexpressed in many tumors, and is correlated, in some cases, with advanced tumor stage or parameters indicating poor prognosis4; and (c) there is no cancer phenotype in the TP73 knockout mouse.5 The recent discovery of TP73 isoforms that are truncated in their transactivation domain suggests that genomic organization could explain these differences.

Whereas TP53 encodes one major protein, TP73 gives rise to a complex number of isoforms with opposing functions: TAp73, {Delta}Ex2p73, {Delta}Ex2/3p73, {Delta}Np73 and {Delta}N'p73. These isoforms can also be processed alternatively at the COOH-terminal (Fig 1A). TAp73 variants contain the NH2-terminal transactivation domain and largely mimic p53 function in experimental systems.6 The {Delta}Ex2p73 and {Delta}Ex2/3p73 isoforms lack exon 2 and exons 2 and 3, respectively.1,7 {Delta}Np73 is generated from an alternative promoter in intron 3 and contains a newly described 3' exon.8 This variant plays an essential antiapoptotic role during mouse development, counteracting p53-mediated neuronal death in vivo.9 Interestingly, the {Delta}N'p73 variant is generated from the first promoter, but aberrantly includes 198 base pairs (bp) from the 3' exon. Translation of the {Delta}N'p73 transcript starts in the 3' exon, resulting in the production of a protein that is indistinguishable from {Delta}Np73 (Fig 1B).10 {Delta}Ex2p73, {Delta}Ex2/3p73, {Delta}Np73 and {Delta}N'p73 (so-called {Delta}TAp73) are transactivation-deficient isoforms that fail to induce apoptosis and cell cycle arrest by acting as direct competitors for the DNA binding-sites and/or by heteroduplex formation with p53 and the transactivation-competent TAp73 variants, inhibiting their tumor suppressor properties.8,11,12 These findings, along with the description that p53 and TAp73 can induce the expression of the specific {Delta}Np73 variant in vitro by direct binding to its promoter, indicate an autoregulatory feedback loop that may modulate cell survival and death.13,14 In addition, {Delta}TAp73 isoforms confer drug resistance on wild-type p53 and TAp73 harboring tumor cells,8 and act as oncogenes transforming NIH3T3 cells and making them tumorigenic in nude mice.15 Petrenco et al16 report that the specific {Delta}Np73 isoform promotes immortalization in primary cells and cooperates with oncogenic Ras to induce their transformation in vivo, fulfilling the classic criteria for a cooperating oncogene.


Figure 1
View larger version (24K):
[in this window]
[in a new window]
  		Fig 1. (A) Main TP73 COOH-terminal splice transcripts ({alpha}, ß, {gamma}, {delta}, {epsilon}, {eta}, and {zeta}). Arrows indicate the start sites of the two promoter regions. Green represents untranslated sequences; blue, transactivation domain; and orange, exon 3'–derived coding sequences. (B) Exon structure of each individual NH2-terminal mRNA variant, promoter from which they are transcribed, encoded protein, and transactivation potential.

 
Inhibition of p53 and TAp73 tumor suppressor activity is not the only mechanism through which {Delta}TAp73 forms exert their oncogenic action. Stiewe et al17 report that all {Delta}TAp73 isoforms induce similar degrees of in vitro phosphorylation of the retinoblastoma tumor suppressor protein phosphorylated Rb (pRb) and, consequently, its inactivation. {Delta}TAp73-mediated phosphorylation of pRb results in enhanced E2F activity, suggesting that {Delta}TAp73 variants might also interfere with the pRb tumor suppressor pathway. Interestingly, E2F-1 could activate TP73 transcription through its binding motifs, located in the noncoding regions of the two TP73 promoters,15,18 although some authors suggest that the second alternative promoter may not be regulated directly by E2F.19

It is important to note that, to date, most studies identifying TP73 overexpression in primary human tumors have examined total levels of TP73, whereas nearly all of the studies analyzing specific variants only utilized a small number of tumors.19,20,21 Some exceptions exist nevertheless. A semiquantitative study in breast cancer showed overexpression of the specific {Delta}Np73 variant in 31% of the 52 cases analyzed.8 Overexpression of both {Delta}Np73 and TAp73 variants was observed in 85% of 51 patients with chronic B-cell lymphocytic leukemia.22 A recent study in 100 ovarian cancer cases with a complete expression profile of all NH2-terminal truncated isoforms showed their differential expression patterns.23 Notably, overexpression of the specific {Delta}Np73 form in patients with neuroblastoma was significantly associated with reduced survival and served as an independent prognostic marker in lung cancer.24,25

In an attempt to further characterize this complex pattern of expression in human tumors and to assess its role in carcinogenesis, we address here the real-time quantification of full-length TP73 (TAp73) and NH2-terminal truncated isoforms ({Delta}TAp73) derived from the two TP73 promoters in a series of 113 and 60 patients diagnosed with colon and breast carcinomas, respectively. Moreover, we analyze which TP73 variants could be responsible for inducing the expression of E2F-1 and whether the concomitant expression of specific TP73 variants and oncogenic K-ras could influence the malignant phenotype of primary tumors. Throughout the text, {Delta}TAp73 refers collectively to the NH2-terminal truncated variants analyzed here ({Delta}Ex2p73, {Delta}Ex2/3p73 and {Delta}Np73). {Delta}Np73 refers exclusively to the specific transactivation-deficient isoform which derives from the second alternative promoter (Fig 1B). The association between expression of aberrant TP73 isoforms and pathologic parameters of the colon and breast tumors analyzed supports their possible oncogenic function and their potential as prognostic markers. This is the first study in colon and breast cancer patients to examine the entire complex network and determine its possible clinical relevance.


   PATIENTS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 Glossary
 REFERENCES
 
Patients, Tumor Samples, and Nucleic Acid Extraction
The present study, approved by the research ethics board of Hospital Universitario Puerta de Hierro (Madrid, Spain), was based on a consecutive series of 113 and 60 patients undergoing surgery for colorectal and breast cancer, respectively, between January 1998 and January 2003. All colon cancer patients were considered sporadic cases on the basis that no clinical antecedents of familiar adenomatous polyposis were reported, and those meeting the clinical criteria for hereditary nonpolyposis colorectal cancer (Amsterdam criteria) were excluded. Sporadic breast cancer patients selected for the study showed no evidence of disseminated disease at diagnosis. Both nontumor and tumor tissues were obtained sequentially, immediately after surgery, snap-frozen in liquid nitrogen and stored at –80°C until processing.

All tumors were histologically examined by a pathologist to (a) confirm the diagnosis of colon or breast adenocarcinoma and identify the histologic breast cancer subtype, (b) verify the presence of tumor and select those samples with at least 75% tumor tissue, and (c) establish the pathologic stage.

DNA and RNA were extracted from approximately 30 mg of colon and breast tumor and healthy tissue samples using the QIAmp DNA Mini Kit and RNeasy Mini Kit, respectively (Quiagen Inc, Hilden, Germany). After extraction, nucleic acids were quantified spectrophotometrically.

Primer Design
Primer sets for TAp73, Ex2p73 and {Delta}Np73 were as described previously.23 Primer pairs for Ex2/3p73 and E2F-1 were designed using Primer Express version 2.0 (Applied Biosystems, Foster City, CA). For TAp73, Ex2p73, and Ex2/3p73, primers spanning splice junctions were used to amplify the specific variants. The TAp73 set amplifies all the isoforms containing the transactivation domain. For {Delta}Np73, the forward primer detects a sequence unique to this transcript (5' untranslated region of the 3' exon). The housekeeping genes TATA binding protein (TBP), succinate dehydrogenase complex subunit A (SDHA), and ubiquitin C (UBC) were used as to normalize gene expression results. The specificity of each primer set was confirmed by melting curve analyses and detection of single bands of amplicons of the expected size on nondenaturing 8% polyacrylamide gels followed by sequencing. The sequences of the primer sets and the reaction conditions are shown in Table 1.


View this table:
[in this window]
[in a new window]
  		Table 1. Sequence of Primer Pairs and Conditions for TP73 Isoforms, E2F-1, and Internal Control Genes

 
Real-Time Polymerase Chain Reaction
mRNA levels were calculated in the healthy and tumor counterpart samples using a relative quantification approach in which the amount of the targets is expressed in relation to the geometric average of the three reference housekeeping genes, as described previously.26 The relative concentrations of target and reference genes were calculated by interpolation using a standard curve of each gene generated from a serial dilution of a cDNA prepared from the RNA of an individual expressing the specific analyzed gene. The expression level of the target gene in a patient was calculated as a ratio: target in tumor tissue to target in normal tissue (T:N). For the synthesis of the first-strand cDNA, 400 ng of total RNA was reverse transcribed using the Gold RNA PCR Core Kit (Applied Biosystems), according to the manufacturer's instructions. Random hexamers were used for cDNA synthesis.

Real-time polymerase chain reaction (PCR) was performed in a Light-Cycler apparatus (Roche Diagnostics, Mannheim, Germany) using the LightCycler-FastStart DNA Master Plus SYBR Green I Kit (Roche Diagnostics). Each reaction was performed in a final volume of 20 µL containing 4 µL of cDNA, 0.5 µmol/L of each primer, and varying concentrations of dimethyl sulfoxide (Table 1), as well as 1x reaction mix including FastStar DNA polymerase, reaction buffer, deoxyribonucleotide triphosphates (dNTPs) and SYBR green. Thermal cycling for all genes was initiated with a denaturation step of 95°C for 10 minutes and then subjected to 40 cycles of PCR (denaturation at 94°C for 10 seconds, annealing at different temperature for each gene [Table 1] for 5 seconds, and elongation at 72°C for 10 seconds, during which fluorescence was acquired).

TAp73 and {Delta}Np73 Immunohistochemistry
Immunophenotype analysis of 25 colon and 14 breast human samples showing differential mRNA expression of TAp73 and {Delta}Np73 variants was performed according to standard procedures, with overnight incubation in the presence of the following primary antibodies: (1) a mouse monoclonal p73 antibody (KAM-CC242F, clone 5B429; Stressgen, Victoria, Canada, diluted 1/100) epitope corresponding to the NH2-terminal region (this antibody recognizes the TAp73 isoforms but does not detect the {Delta}Np73 variant or p53) and (2) a mouse monoclonal {Delta}Np73 antibody (OP181, clone 38C674; Calbiochem, EMD Biosciences, Darmstadt, Germany; diluted 1/100) developed against a peptide corresponding to amino acids 2-13 of human {Delta}Np73 (LYVGDPARHLAT). Mouse and human sequences are more than 95% identical at these amino acid residues. This antibody does not cross react with any TAp73 isoform or p53.27 Immunodetection was performed with peroxidase-labeled streptavidin biotin (LSA; DAKO, Glostrup, Denmark) using diaminobenzidine chromagen as substrate. All immunostaining was performed using the TechMate 500 (DAKO) automatic immunostaining device. Choroid plexus from a human fetus was used as positive control for both antibodies. TAp73 and {Delta}Np73 proteins were considered positive in tissue samples exhibiting nuclear staining in > 10% of the epithelial cells.

Mutational Status of K-Ras Exon 1
In the colon specimens, PCR amplification of K-ras was carried out in a 25 µL reaction volume with a final concentration of 1x PCR buffer, 1.5 units of Ampli Taq DNA polymerase (Perkin-Elmer, Roche Molecular Systems Inc, Branchburg, NJ), 200 µmol/L dNTPs mix, 0.6 µmol/L of each primer; 2.5 mmol/L MgCl2, 100 ng of genomic DNA as template, and distilled water to reach the total volume. For amplification, each sample was denatured at 94°C for 5 minutes and subjected to 35 cycles of PCR (94°C for 30 seconds, 58°C for 40 seconds, and 72°C for 30 seconds) followed by a final 7 minutes extension at 72°C. The amplified products of K-ras amplification were denatured by mixing with 15 µL of stop solution containing 98% formamide, 0.02% xylene cyanol, and 0.02% bromophenol blue, and heated to 95°C for 6 minutes and rapidly cooled on ice. Electrophoresis was performed on nondenaturing 12% polyacrylamide gels at 250 V for 12 hours at room temperature. The allelic band intensity on the gels was assessed nonradioisotopically using a commercially available silver staining method.28 Primers used for amplification of exon 1 of K-Ras, which contains codons 12 and 13 were as follows: 5' GACTGAATATAAACTTGTGGTAGT 3' and 5' CTATTGTTGGATCATATTCGTCC 3'. The bands that displayed a different mobility shift pattern were sequenced in an ABI Prism 377 DNA sequencer (PE Biosystem, Foster City, CA).

Analysis
p53 immunophenotypic analysis in colon and breast samples was performed according to standard procedures, with overnight incubation in the presence of the cl1801 mouse monoclonal antibody (Oncogene Sciences, Manhasset, NY). Immunodetection was performed with peroxidase-labeled streptavidin biotin (LSA; DAKO) using diaminobenzidine chromogen as substrate. All immunostaining was performed using the TechMate 500 (DAKO) automatic immunostaining device. cl1801 mouse monoclonal antibody was used because of its ability to detect up to 89% of TP53 point mutations.29 Tissue samples exhibiting definitive nuclear (or nuclear and cytoplasmic) staining in > 10% of the epithelial cells were considered positive for p53. Cases displaying no nuclear staining were considered negative.

Data Analysis
The following parameters were obtained from the medical records of the 113 colon cancer patients: age, sex, tumor side, lymph node metastases (LNM), pathologicstage, vascular invasion, tumor differentiation, and existence of polyps (defined by the presence of polyps in the surgical specimen). Pathologic stage was assessed using the TNM classification. Presence of lymph node metastases was evaluated by optical microscopy. No other immunohistochemical or molecular techniques were used (Table 2).


View this table:
[in this window]
[in a new window]
  		Table 2. Associations Between Geometric Average of Expression Levels of the Specific Tp73 Isoforms and Pathologic and Molecular Characteristics of the Colon Cancer Patient Series

 
Parameters obtained from the medical records for the 60 breast cancer patients were as follows: age, tumor size, LNM, presence of steroid receptors (estrogen and progesterone), pathologic stage, histologic grade, proliferative index, erb-B2 expression, and vascular invasion (Table 3). Pathologic stage was assessed using the TNM classification. Steroid receptor content was determined using an immunohistochemical procedure. The proliferative index was calculated using the Ki-67 antigen (Inmunotech, Westbrook, ME) in immunohistochemical analyses and was considered elevated on those cases exhibiting nuclear positive staining of ≥ 15% of the epithelial cells. erb-B2 expression was evaluated using the mouse monoclonal antibody CB11 (Novocastra Lab Ltd, Newcastle, United Kingdom). Levels of erb-B2 were considered overexpressed when ≥ 15% of the epithelial cells of the tissue samples displayed intense membrane positive staining.


View this table:
[in this window]
[in a new window]
  		Table 3. Associations Between Expression Levels of the Specific TP73 Isoforms and Pathologic and Molecular Characteristics of the Breast Cancer Patient Series

 
Because the values of gene expression (T:N ratio) displayed a non-normal distribution (Kolmogozov-Smvinov test, Lilliefors correction), the data were normalized by using log10 transformation. For the same reason, we used the geometric rather than the arithmetic average of the T:N ratio to describe the gene expression data. The variables were contrasted by analysis of variance or the Pearson coefficient correlation. When the distribution was not normalized using log10 transformation, as with the E2F-1 data, the Spearman coefficient correlation was used to contrast the variables. In all statistical tests, two-tailed P values ≤ .05 were considered statistically significant. Statistical analysis was performed using the Statistical Package for the Social Sciences version 11.0 (SPSS Inc, Chicago, IL).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 Glossary
 REFERENCES
 
Coexpression of TP73 Isoforms in Colon and Breast Tumors
The mRNA levels of individual TP73 variants were examined in colon and breast tumor and healthy counterpart tissues. The median, minimum, and maximum, and 25th and 75th percentiles for {Delta}Ex2p73, {Delta}Ex2/3p73, {Delta}Np73, and TAp73 expression are shown in Table 4.


View this table:
[in this window]
[in a new window]
  		Table 4. Median, Minimum, and Maximum, and 25th and 75th Percentiles of {Delta}Ex2p73,{Delta}Ex2/3p73,{Delta}Np73, TAp73 and E2F-1 Expression Levels for Colon and Breast Cancer Samples

 
A strong, direct statistically significant correlation was found between the expression levels of all the TP73 isoforms in the colon and breast cancer samples (Table 5), indicating that the expression levels of TP73 variants increase in parallel in tumor tissues. Although a trend was observed between {Delta}Ex2/3p73 and TAp73 expression levels in breast samples, it did not achieve statistical significance (Table 5). Weaker statistical correlations were observed between {Delta}Ex2/3p73 and TAp73 in colon samples and between TAp73 and {Delta}Ex2p73, and TAp73 and {Delta}Np73 in breast samples (Table 5). Even though {Delta}Np73 arises from the second alternative TP73 promoter, its expression levels show a strong correlation with the expression of the first TP73 promoter isoforms.


View this table:
[in this window]
[in a new window]
  		Table 5. Correlations Between Expression Levels of all TP73 Isoforms, and E2F-1 Levels for Colon and Breast Carcinoma Cases

 
mRNA Quantitative Expression Versus Immunohistochemistry
Twenty-five colon and 14 breast cancer cases were analyzed for TAp73 and {Delta}Np73 protein expression by immunohistochemistry utilizing TAp73- and {Delta}Np73-specific antibodies. Like most other TAp73 antibodies, this antibody cannot distinguish among the various TAp73 isoforms. TAp73 immunoreactivity was observed in 19% and 21% of the colon and breast cancer cases, respectively (Fig 2). TAp73 protein expression correlated with mRNA quantification in 22 (88%) of the 25 colon cases and in 12 (86%) of the 14 breast samples. The cases that did not present a protein-mRNA correlation showed no TAp73 protein and moderate mRNA levels. {Delta}Np73 protein expression was observed in 33% and 30% of the colon and breast cancer cases, respectively (Fig 2). {Delta}Np73 protein expression correlated with mRNA levels in 21 (84%) of the 25 colon cases and 11 (79%) of the 14 breast samples. The seven cases that did not show a correlation presented either no {Delta}Np73 protein and moderate mRNA levels or moderate {Delta}Np73 protein expression and low mRNA levels.


Figure 2
View larger version (82K):
[in this window]
[in a new window]
  		Fig 2. (A-F) TAp73 and (G-L) {Delta}Np73 immunohistochemistry. (A, D, G, J) Human fetus choroid plexus was used as positive control. TAp73-expressing tumor cells showed deep brown nucleus in (C) colon and (F) breast. No TAp73 immunoreactivity was shown in (B) colon and (E) breast. {Delta}Np73 positive cells have deep nuclear staining (I, L). No {Delta}Np73 immunoreactivity (H, K). Magnification, 200x and 400x.

 
Association Between p53 and TP73 Status
Redundant alterations affecting the same pathway may not confer extra growth advantages on tumor cells; therefore, TP53 mutations and upregulation of the TP73 oncogenic isoforms may be mutually exclusive. Positive p53 immunostaining (nuclear), suggesting TP53 mutations, was observed in 81 (72%) of 113 colon patients and in 23 (38%) of 60 breast patients. In the colon cancer cases, an association was found between negative p53 staining (no nuclear immunostaining) and overexpression of {Delta}Ex2p73 (P = .05) and TAp73 (P = .05; Table 2). The geometric average for {Delta}Ex2p73 levels was 0.5 when p53 staining was negative, and 0.1 when positive. For TAp73 expression levels, the geometric average was 1.3 for negative p53 staining, and 0.4 when positive. The same association was not observed for {Delta}Ex2/3p73 and {Delta}Np73 forms. When cases were divided into tertiles, we observed that 17 (94%) of 18 patients with the lowest expression of both {Delta}Ex2p73 and TAp73 (first tertile) showed positive p53 staining, whereas 23 (64%) of 36 patients with the highest expression levels for {Delta}Ex2p73 and/or TAp73 (third tertile) displayed positive immunostaining (P = .02). Moreover, 43% of patients exhibiting high expression of {Delta}Ex2p73 and low expression of TAp73 displayed positive p53 staining compared with 78% of individuals with low levels of {Delta}Ex2p73 and high expression of TAp73. This association did not achieve statistical significance because of the reduced number of patients in each subgroup. In our breast cancer series, a statistical association was also observed between wild-type p53 status and overexpression of the {Delta}Np73 variant (P = .04), with geometric averages 1.4 and 0.3 for negative and positive p53 staining, respectively (Table 3). Although it was not statistically significant, the same association was also observed for the remaining TP73 TA-truncated isoforms. The trend was much less evident for the TAp73 isoform.

Cooperation of TP73 Isoforms With Oncogenic K-Ras in Tumorigenesis
{Delta}Np73 has been classified as an immortalizing protein that cooperates with oncogenic Ras to transform primary fibroblasts.16 We analyzed whether high expression levels of {Delta}Np73 and occurrence of oncogenic K-ras coincide in colon tumor specimens, suggesting a selection of cells harboring both alterations during tumorigenesis in humans. K-ras mutation at codons 12 and/or 13 was observed in 34 (30%) of 113 patients. Our results showed no statistical association between overexpression of {Delta}Np73 and presence of K-Ras mutations. We also found no association between the remaining {Delta}TA/TAp73 isoforms and oncogenic K-Ras (Table 2).

Induction of E2F-1 by {Delta}TAp73 Isoforms
E2F-1 has been described to activate TP73 isoform transcription.15,18 Additionally, {Delta}TAp73 isoforms could induce activation of E2F through the hyperphosphorylation of pRb.17 We analyzed whether overexpression of {Delta}TAp73 isoforms correlates with upregulation of E2F-1 mRNA levels in our colon and breast tumor series. The median, minimum, and maximum, and 25th and 75th percentiles for E2F-1 expression are shown in Table 4 for colon and breast samples. A direct correlation was found between expression of E2F-1 and {Delta}Ex2p73 (P = .009; r = 0.26) and TAp73 (P = .036; r = 0.20) in colon samples (Table 5). In the breast cases, we observed direct correlations between E2F-1 expression and {Delta}Ex2p73 (P = .05; r = 0.26), {Delta}Ex2/3p73 (P = .05; r = 0.33), and TAp73 (P = 0.001; r = 0.43; Table 5).

Association With Colon Tumor Pathologic Data
Analysis of the relationship between TP73 isoform expression and pathologic data revealed some significant associations in colon cancer patients (Table 2). An association was found between tumor stage and expression of {Delta}Ex2/3p73 and {Delta}Np73 isoforms. {Delta}Ex2/3p73 expression was significantly higher in stage IV (P = .03), with geometric averages of 0.38 for stage I, 0.35 for stage II, 0.36 for stage III, and 25.55 for stage IV (Fig 3A). {Delta}Np73 levels increased significantly in parallel with the stage (P = .011), as indicated by the geometric average of its expression (0.06 in stage I, 0.19 in stage II, 0.46 in stage III, and 11.12 in stage IV; Fig 3B).


Figure 3
View larger version (11K):
[in this window]
[in a new window]
  		Fig 3. Association between expression levels of (A) {Delta}Ex2/3p73 and (B) {Delta}Np73 variants and tumor stage. Data on TP73 isoforms have been normalized using a log10 transformation. The graphs show the 25th, 50th, and 75th percentiles and values lower than 1.5 box lengths.

 
An association was found between presence of polyps in the surgical specimen and upregulation of {Delta}Ex2p73 (P = .03), {Delta}Ex2/3p73 (P = .04), and TAp73 (P = .01). The geometric average expression in patients with absence (71.7%) and presence (28.3%) of polyps was 0.17 and 0.45 for {Delta}Ex2p73, 0.3 and 1.28 for {Delta}Ex2/3p73, and 0.4 and 1.7 for TAp73, respectively.

{Delta}Np73 overexpression was significantly associated with vascular invasion (P = .02). The geometric average {Delta}Np73 level of the 68 (60.2%) of 113 patients who did not show vascular invasion was 0.14; the remaining 39.8% with vascular invasion had a geometric average expression of 0.65.

Presence of lymph node metastases was associated with high levels of the {Delta}Ex2/3p73 variant (P = .04). The geometric average for the expression of the isoform in the 37 (32.75%) of 113 patients harboring lymph node metastases was 1.7 and in those without lymph node metastases (76 [67.25%] of 113) it was 0.4.

An association was observed between rectum tumor localization and upregulation of TAp73 variants (P = .004). The geometric average for TAp73 levels was 0.62, 0.22, and 1.8 for left, right, and rectum colon localization, respectively. A trend was also observed between rectum localization and overexpression of the {Delta}Ex2p73 isoform (P = .06). The geometric average of {Delta}Ex2p73 levels for left, right, and rectum colon localization was 0.17, 0.16, and 0.52, respectively.

Association With Breast Tumor Pathologic Data
Analysis of the relationship between the expression levels of TP73 variants and the pathologic data revealed significant associations in the breast series (Table 3). A significant association was observed between vascular invasion and overexpression of {Delta}Ex2p73 (P = .05). The geometric average levels for the patients harboring vascular invasion (41.7%) was 0.9, and for the remaining patients without this pathologic feature it was 0.3. A trend was also found between {Delta}Np73 overexpression and vascular invasion (P = .06).

Interestingly, some trends were found between overexpression of TP73 variants and the hormone receptors: high levels of {Delta}Ex2p73 and {Delta}Ex2/3p73 variants were associated with estrogen negative receptors (P = .06 and P = .07, respectively) and overexpression of TAp73 isoform was associated with progesterone negative receptors (P = .06).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
Authors' Disclosures of...
 Author Contributions
 Glossary
 REFERENCES
 
Although TP53 mutations are the most frequent alteration in human tumors, inactivating mutations affecting the TP53-homolog TP73 are rare. However, increased expression levels of wild-type TP73 are a common event in human malignancies.30,31,32,33 The association of TP73 overexpression with advanced tumor stage and/or parameters indicating poor prognosis30,31 may indicate a role in tumorigenesis. The recent discovery of NH2-terminally truncated p73 variants ({Delta}TAp73) with opposite functions to the tumor suppressor p53 and the p73 full-length variants (TAp73) led us to undertake a detailed and comprehensive clinical analysis of their expression in tumor tissue. Here we have quantified the expression levels of the transactivation-competent TAp73 variants and the NH2-terminally truncated {Delta}TAp73 isoforms ({Delta}Ex2p73, {Delta}Ex2/3p73, and {Delta}Np73), in two large series of colon and breast cancer patients. Although expression levels of TP73 isoforms have been described to vary minimally among normal tissues from different organs,23 the availability of tumor and normal counterpart tissue used in the current study provides a good opportunity for the faithful analysis of the changes in expression in tumors.

Both {Delta}TAp73 and TAp73 forms were found to be upregulated in a significant number of the colon and breast tumors examined, indicating a possible involvement in colon and breast tumorigenesis. Other studies examining TP73 variants suggest that their relative expression levels might be tumor specific.23,19 The finding that the expression levels of the analyzed variants directly correlate with each other is surprising, and might indicate that both promoters are regulated by the same stimuli. Analysis of the functional heterocomplexes formed among the tumor suppressor and the oncogenic p73 variants and how their stoichiometry could be influenced by changes in their expression levels in human tumors is crucial to the understanding of whether they have either a tumor-suppressor or an oncogenic role. It is possible that the presence of {Delta}TAp73 variants, even at low levels, completely suppresses the transactivating activity of TAp73, with the consequent elimination of essential TAp73 antitumorigenic function. In addition, at the protein level, {Delta}TAp73 isoforms have been described to be more stable than those of TAp73.12,14

In our colon and breast tumor samples, some associations were observed between expression of wild-type p53 and upregulation of specific TP73 isoforms, supporting the hypothesis that two different alterations in the same pathway might not confer additional growth advantages during carcinogenesis and thereby alleviate the selective pressure on those cells harboring both alterations. Such an association was also observed in a previous study in which we analyzed total expression levels of TP73.34 The fact that both alternations are not found concomitantly suggests that p73 can inactivate the p53 tumor supressor pathway. In this context, p73 could be considered to act as an oncogene. Overexpression of wild-type TP73 was thought to be a mechanism to compensate for TP53 inactivation, a scenario in which p73 would carry out the activities of p53. However, such an association (TP73 upregulation and mutated TP53) has not been observed, suggesting that p73 might not play a tumor-suppressor role.

{Delta}Np73 is the only p73 variant under the control of the second alternative promoter (Fig 1B). This cryptic promoter can be activated by both wild-type p53 and TAp73 variants.14,35 The upregulation of the specific {Delta}Np73 variant observed in our series could be a result of activation of this second promoter by increased levels of TAp73 forms in the colon and breast tumor samples. In our breast series, the association found between wild-type p53 status and upregulation of the {Delta}Np73 isoform could also be a result of the transactivation of the {Delta}Np73 promoter by p53.

In vitro, the specific {Delta}Np73 isoform causes immortalization of primary fibroblasts and rescues them from Ras-induced senescence; in addition, it cooperates with oncogenic Ras in transforming them in vivo.16 We hypothesized that oncogenic Ras and upregulation of {Delta}Np73 variant could be common alterations acquired consecutively during human tumorigenesis. In our colon and breast tumor series, we could not confirm our hypothesis as a statistical association between activated K-Ras and overexpression of either {Delta}Np73 or the remaining TP73 variants was not found. Therefore, in human colon and breast tumorigenesis, the {Delta}Np73 variant might cooperate with other oncogenes in the process of transformation. Identification of oncogenes that can cooperate with the specific {Delta}Np73 form might help to identify individuals at higher risk of developing cancer.

Some novel results were obtained in the analysis of our colon and breast cancer series. A correlation between E2F-1 and {Delta}Np73 expression levels was not observed, supporting the suggestion that the intronic alternative TP73 promoter may not be directly regulated by E2F-1.19 However, some correlations were found between mRNA levels of E2F-1 and TP73 variants derived from the first promoter. These correlations could be explained in different ways. While the first TP73 promoter is a known target of E2F,36 {Delta}TAp73 isoforms can also inactivate pRb tumor suppressor protein, resulting in E2F release.17 In our study, it is difficult to know whether E2F-1 activates the expression of first-promoter–derived TP73 variants or whether E2F-1 upregulation is a consequence of pRb inactivation by {Delta}TAp73 forms. Certainly, a positive feedback loop may exist.

Colorectal and breast cancers are two of the most frequent malignancies in Western societies, and remain associated with high mortality rates. In this context, the search for molecular markers that could help to either detect the disease at early stages or predict the tumor behavior and response to therapy is extremely important. Therefore, the clinical significance of the upregulation of TP73 variants in these tumor types is of particular interest. The association of the overexpression of TP73 isoforms with poor-prognosis tumor features could highlight their role as oncogenes. In our colon cancer series, the upregulation of TP73 variants was associated with tumor stage, lymph node metastases, vascular invasion, presence of polyps, and tumor localization (Table 2). Overexpression of {Delta}Ex2/3p73 and {Delta}Np73 was associated with more advanced stages; specifically, expression levels of {Delta}Ex2/3p73 were significantly higher in stage IV and {Delta}Np73 levels increased in parallel with the stage. Therefore, {Delta}Ex2/3p73 and {Delta}Np73 may be markers of malignant potential in this tumor type.

Currently, pathologic stage is the prognostic factor that has the most clearly demonstrated practical use in colorectal cancer, with the 5-year survival of stage I patients (close to 90%) contrasting strongly with that of stage IV patients (< 10%).37 In a recent study in lung cancer, the percentage of patients showing positive expression of the oncogenic {Delta}Np73 form was higher for stage III and was associated with a lower 5-year survival.25 In addition, {Delta}Np73 variant expression is a predictor of unfavorable outcome in neuroblastoma.24 Taken together, these observations suggest that a follow-up of our patient series for relapse and overall survival regarding TP73 isoforms expression status will provide additional information on the prognostic value of the expression levels of these oncogenic TP73 variants in these tumor types. Nevertheless, the correlation already observed with the pathologic stage could anticipate its value as a prognostic marker. Notably, {Delta}TAp73 variants have been described to confer drug resistance and might also predict treatment responsiveness.14

Interestingly, an association was observed between patients displaying {Delta}Ex2p73 or TAp73 overexpression and rectum tumor localization. Two pathways for colorectal carcinogenesis have been defined: the suppressor and the mutator. Patients with the mutator phenotype are characterized by inactivation of mismatch repair genes, consequently harboring microsatellite instability, and show their tumor in the right side of the colon.38 Perhaps overexpression of these two TP73 variants could help to identify colorectal tumors form the suppressor pathway.

The most remarkable association found in our breast cancer series is the correlation between TP73 variants and the hormone receptors (Table 3). The association observed between upregulation of {Delta}Ex2p73 and negative estrogen receptors and between TAp73 and negative progesterone receptors indicates that the expression of these variants could be used as a marker for patient suitability for hormone therapy. Moreover, the association observed between {Delta}Ex2p73 and {Delta}Np73 and vascular invasion highlights the possible oncogenic role of the transactivation truncated p73 variants in breast carcinogenesis.

Upregulation of the tumor suppressor TAp73 variants in both the colon and breast samples was associated with certain features associated with poor prognosis. This may be explained by the fact that suppressor TAp73 and putative oncogenic {Delta}TAp73 forms are coexpressed in the tumor samples and, even though TAp73 variants are upregulated, the oncogenic isoforms may cancel their suppressor function, resulting in a prevalent oncogenic activity.

The p73 NH2-terminal truncated variants could be alternatively spliced at the COOH-terminal (Fig 1A). This region contains a sterile alpha motif (SAM) and a proline-rich domain.39,40 The SAM domain is involved in protein-protein interactions, and is present in proteins whose functions range from signal transduction to transcriptional repression.39 p73{alpha}, p73{epsilon}, and p73{zeta} contain SAM domains.39 p73{alpha} transactivates p53 target genes to a lesser extent than p73ß, suggesting that the p73 SAM domain is involved in transcriptional regulation.41 A study quantifying the expression levels of specific variants that harbor simultaneous splicing alternatives at the 3' and 5' terminal regions in human tissues could reveal how the COOH-terminal splicing affects p73 activity and which combination of NH2- and COOH- processing is involved in tumorigenesis. If displaying a truncated NH2-terminal implies a transactivation deficiency, the processing at the COOH-terminal may have little effect on the protein function. Unfortunately, it is difficult to perform such a study.

In conclusion, the association of upregulation of {Delta}TAp73 variants with poor prognostic features of tumors is suggestive of a possible oncogenic role and indicates that they may be of value as molecular prognostic markers. This is the case for the {Delta}Ex2/3p73 and {Delta}Np73 variants, whose overexpression in colon cancer patients is associated with advanced pathologic stage. Nevertheless, a follow-up of our patient series to confirm the association of overexpression of {Delta}Ex2/3p73 and {Delta}Np73 isoforms with lower survival is mandatory to assess the predictive value of these molecular parameters. In this context, a step further will be consideration of the treatment that these patients received to determine whether overexpression of these variants are prognostic for clinical outcomes or whether they are predictive of differential benefits from specific therapies. p53 immunohistochemical status is widely included in the medical records of cancer patients. However, the modifier action that {Delta}TAp73 variants could exert on p53 suggests that analysis of TP73 isoforms levels should be considered.


   Authors' Disclosures of Potential Conflicts of Interest
TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
Author Contributions
 Glossary
 REFERENCES
 
The authors indicated no potential conflicts of interest.


   Author Contributions
TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
Glossary
 REFERENCES
 

Conception and design: Gemma Domínguez

Provision of study materials or patients: Constanza Maximiano, María E. Gómez, Jose A. Rivera, Carmen García-Andrade

Collection and assembly of data: Gemma Domínguez, Jose M. García, Cristina Peña, Javier Silva, Vanesa García, Lara Martínez

Data analysis and interpretation: Gemma Domínguez, Lara Martínez, Felix Bonilla

Manuscript writing: Gemma Domínguez, Felix Bonilla

Final approval of manuscript: Gemma Domínguez, Jose M. García, Cristina Peña, Javier Silva, Vanesa García, Lara Martínez, Constanza Maximiano, María E. Gómez, Jose A. Rivera, Carmen García-Andrade, Felix Bonilla

 


   Glossary
TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 Glossary
REFERENCES
 
E2F-1: Regulator of S-phase–specific genes required for cell cycle progression, the acetylation of E2F has a positive effects on its DNA-binding functions, thereby stimulating transcription. When complexed with Rb, it acts as a transcriptional repressor.

Isoforms: Arising from a differential exon-splicing process, isoforms are proteins derived from the same gene but have distinct physical, and sometimes biologic, properties.

Oligomerization: The forming of a compound (polymer) by the combination of relatively few smaller molecules (monomers).

SDHA (succinate dehydrogenase complex subunit A): This protein is one of the four components of the enzymatic mitochondrial complex II which is involved in the mitochondrial respiratory chain. It is consider a housekeeping gene because of its essential function in cells.

TAp73: TP73 isoforms, which contain the DNA-binding, the oligomerization, and transactivation domains. TAp73 proteins largely mimic p53 suppressor functions in experimental systems and are capable of inducing cell cycle arrest and cell death in response to DNA damage.

{Delta}TAp73: {Delta}Ex2p73, {Delta}Ex2/3p73, {Delta}Np73, and {Delta}N'p73, so called {Delta}TAp73, are transactivation-deficient TP73 variants that are generated through alternative processing at the NH2-terminal region or differential promoter usage. {Delta}TAp73 proteins fail to induce apoptosis and cell cycle arrest by acting as direct competitors for the DNA binding-sites and/or by heteroduplex formation with p53 and the transactivation-competent TAp73 variants, inhibiting their tumor suppressor properties.

TBP: Gene coding for the TATA box-binding protein, a transcription initiation factor. TBP plays a key role in the activation and regulation of eukaryotic promoters that occurs when it binds to TATA elements in promoter regions, initiating the assembly of a preinitiation complex involving RNA polymerase II and several initiation factors.

TP73: Family member of the tumor suppressor gene TP53. Although p73 was initially described as a tumor suppressor protein, nowadays is accepted that it could exert both a tumor suppressor or an oncogenic function depending on its isoforms.

Transactivation: Induction of the transcription by a transcription factor binding to DNA and activating adjacent proteins.

UBC (ubiquitin C): Protein involved in the process of protein turnover in eukaryotic cells. Its essential function qualifies UBC as a housekeeping gene.


   Acknowledgment
 
We thank Robin Rycroft for help with the English manuscript; Teresa Gordillo, RN, and Ana Belen Hernández, RN, for help with the collection of blood samples; and Sonsoleo Aso for assistance with the immunohistochemistry.


   NOTES
 
Supported by Instituto de Salud Carlos III Grant No. CP03/00032 and Spanish Ministry of Education and Science Grant No. 2004-01002.

Terms in blue are defined in the glossary, found at the end of this article and online at www.jco.org.

Authors' disclosures of potential conflicts of interest and author's contributions are found at the end of this article.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 Glossary
 REFERENCES
 
1. Kaghad M, Bonnet H, Yang, et al: Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell 90:809-819, 1997

2. Irwin MS, Kaelin WG: p53 family update: p73 and p63 develop their own identities. Cell Growth Differ 12:337-349, 2001[Free Full Text]

3. Melino G, De Laurenzi V, Vousden KH: p73: Friend or foe in tumorigenesis. Nat Rev Cancer 2:605-615, 2002[CrossRef][Medline]

4. Moll UM, Erster S, Zaika A: p53, p63 and p73: Solos, alliances and feuds among family members. Biochim Biophys Acta 1552:47-59, 2001[Medline]

5. Yang A, Walker N, Bronson R, et al: p73-deficient mice have neurological, pheromonal and inflammatory defects but lack spontaneous tumours. Nature 404:99-103, 2000[CrossRef][Medline]

6. Jost CA, Marin MC, Kaelin WG Jr: p73 is a simian [correction of human] p53-related protein that can induce apoptosis. Nature 389:191-194, 1997[CrossRef][Medline]

7. Sherr CJ, Weber JD: The ARF/p53 pathway. Curr Opin Genet Dev 10:94-99, 2000[CrossRef][Medline]

8. Zaika AI, Slade N, Erster SH, et al: deltaNp73, a dominant-negative inhibitor of wild-type p53 and TAp73, is up-regulated in human tumors. J Exp Med 196:765-780, 2002[Abstract/Free Full Text]

9. Pozniak CD, Radinovic S, Yang A, et al: An anti-apoptotic role for the p53 family member, p73, during developmental neuron death. Science 289:304-306, 2000[Abstract/Free Full Text]

10. Ishimoto O, Kawahara C, Enjo K, et al: Possible oncogenic potential of deltaNp73: A newly identified isoform of human p73. Cancer Res 62:636-641, 2002[Abstract/Free Full Text]

11. Fillippovich I, Sorokina N, Gatei M, et al: Transactivation-deficient p73alpha (p73Deltaexon2) inhibits apoptosis and competes with p53. Oncogene 20:514-522, 2001[CrossRef][Medline]

12. Stiewe T, Theseling CC, Putzer BM: Transactivation-deficient delta TA-p73 inhibits p53 by direct competition for DNA binding: Implications for tumorigenesis. J Biol Chem 277:14177-14185, 2002[Abstract/Free Full Text]

13. Nakagawa T, Takahashi M, Ozaki T, et al: Autoinhibitory regulation of p73 by deltaNp73 to modulate cell survival and death through a p73-specific target element within the deltaNp73 promoter. Mol Cell Biol 22:2575-2585, 2002[Abstract/Free Full Text]

14. Grob TJ, Novak U, Maisse C, et al: Human deltaNp73 regulates a dominant negative feedback loop for TAp73 and p53. Cell Death Differ 8:1213-1223, 2001[CrossRef][Medline]

15. Stiewe T, Zimmermann S, Frilling A, et al: Transactivation-deficient deltaTA-p73 acts as an oncogene. Cancer Res 62:3598-3602, 2002[Abstract/Free Full Text]

16. Petrenko O, Zaika A, Moll UM: deltaNp73 facilitates cell immortalization and cooperates with oncogenic ras in cellular transformation in vivo. Mol Cell Biol 23:5540-5555, 2003[Abstract/Free Full Text]

17. Stiewe T, Stanelle J, Theseling CC, et al: Inactivation of retinoblastoma (Rb) tumor suppressor by oncogenic isoforms of the p53 family member p73. J Biol Chem 278:14230-14236, 2003[Abstract/Free Full Text]

18. Putzer BM, Tuve S, Tannapfel A, et al: Increased deltaN-p73 expression in tumors by upregulation of the E2F1-regulated, TA-promoter-derived deltaN'-p73 transcript. Cell Death Differ 10:612-614, 2003[CrossRef][Medline]

19. Stiewe T, Tuve S, Peter M, et al: Quantitative TP73 transcript analysis in hepatocellular carcinomas. Clin Cancer Res 10:626-633, 2004[Abstract/Free Full Text]

20. Tomkova K, Belkhiri A, El-Rifai W, et al: p73 isoforms can induce T-cell factor-dependent transcription in gastrointestinal cells. Cancer Res 64:6390-6393, 2004[Abstract/Free Full Text]

21. Tuve S, Wagner SN, Schittek B, et al: Alterations of deltaTA-p73 splice transcripts during melanoma development and progression. Int J Cancer 108:162-166, 2004[CrossRef][Medline]

22. Leupin N, Luthi A, Novak U, et al: P73 status in B-cell chronic lymphocytic leukaemia. Leuk Lymphoma 45:1205-1207, 2004[CrossRef][Medline]

23. Concin N, Becker K, Slade N, et al: Transdominant deltaTAp73 isoforms are frequently up-regulated in ovarian cancer: Evidence for their role as epigenetic p53 inhibitors in vivo. Cancer Res 64:2449-2460, 2004[Abstract/Free Full Text]

24. Casciano I, Mazzocco K, Boni L, et al: Expression of deltaNp73 is a molecular marker for adverse outcome in neuroblastoma patients. Cell Death Differ 9:246-251, 2002[CrossRef][Medline]

25. Uramoto H, Sugio K, Oyama T, et al: Expression of deltaNp73 predicts poor prognosis in lung cancer. Clin Cancer Res 10:6905-6911, 2004[Abstract/Free Full Text]

26. Palmer HG, Larriba MJ, Garcia JM, et al: Snail represses vitamin D receptor expression and responsiveness in human colon cancer. Nat Med 10:917-919, 2004[CrossRef][Medline]

27. Sayan AE, Paradisi A, Vojtesek B, et al: New antibodies recognizing p73: Comparison with commercial antibodies. Biochem Biophys Res Co 330:186-193, 2005[CrossRef][Medline]

28. Oto M, Miyake S, Yuasa Y: Optimization of nonradioisotopic single strand conformation polymorphism analysis with a conventional minislab gel electrophoresis apparatus. Ann Biochem 213:19-22, 1993

29. Sjögren S, Inganäs M, Torbjörn N, et al: The p53 gene in breast cancer: Prognostic value of complementary DNA sequencing versus immunohistochemistry. J Natl Cancer Inst 88:173-182, 1996[Medline]

30. Domínguez G, Silva JM, Silva J, et al: Wild type p73 overexpression and high-grade malignancy in breast cancer. Breast Cancer Res Treat 66:183-190, 2001[CrossRef][Medline]

31. Tannapfel A, Wasner M, Krause K, et al: Expression of p73 and its relation to histopathology and prognosis in hepatocellular carcinoma. J Natl Cancer Inst 91:1154-1158, 1999[Abstract/Free Full Text]

32. Chi SG, Chang SG, Lee SJ, et al: Elevated and biallelic expression of p73 is associated with porgression of human bladder cancer. Cancer Res 59:2791-2793, 1999[Abstract/Free Full Text]

33. Sunahara M, Ichimiya S, Nimura Y, et al: Mutational analysis of p73 gene in localized at chromosome